ࡱ> UWT[ 4bjbj 8>ΐΐ Tg,K3nnn2222222$C462]nn2322*61P¨^0n230K3p07]07$61617J1$n snnn22:nnnK37nnnnnnnnn : LIC procedure (Adapted from: Stols L, et al., Protein Expr Purif 2002 Jun;25(1):8-15) Order primers for PCR. PmlI restriction enzyme pFB LIC,p15LIC (non-cleavable His-tag) 5' CCACCATCACCATCATCACGGAxxxxxxxx up 5' ATCCTTACTACTCACGTCAyyyyyyyyyyyyy dn AleI restriction enzyme pFB LIC 2,p15 LIC 2 (TEV-cleavable His-tag) pFB-GST-LIC, pGST-LIC2 (TEV-cleavable GST-tag) pFB-StrepHt-LIC, p15-StrepHt-LIC (Streptavidin-His-TEV) 5 AACCTCTACTTCCAATCACAAGCGxxxxxxxxxxxxxxx up 5 ATCCTTACTACTCACTCGCTAyyyyyyyyyyyyyyyyyyy dn SspI restriction enzyme pLIC-His, pLIC-GST, pLIC-His-MBP (pET based) TEV-cleavable tag pcHA-LIC, pcMyc-LIC ( based on pcDNA3.1Hygro+) 5 TACTTCCAATCCAATGCGxxxxxxxxxxxxxxxxxxxxxxx up 5 TTATCCACTTCCAATGCGCTAyyyyyyyyyyyyyyyyyyy dn where xxxxxxxxxxxxx = start of your gene yyyyyyyyyyyyyy = end of your gene, non-coding strand Perform PCR reaction. Use linear, or non-ampicillin resistance encoding template DNA if possible. Verify presence of PCR product (5-10 ml on 1% agarose gel). (If template DNA contains gene for ampicillin resistance, add 0.5ml DpnI to remaining volume and incubate 1-2 hrs at 37(C.) Clean PCR product using PCR clean-up kit (Qiagen). Elute in 10 mM Tris (pH=8) Phosphorylate PCR product; combine: ~500 ng of the PCR product 2.3 ml 10X T4 ligase buffer 0.7 ml T4 PNK H2O-to 23 ml and incubate in thermocyler: 37(C - 1.5 hr 65(C - 20 min 4(C - 00:00:00. Create overhangs within PCR product; add to the tube from step 3: 22 ml H2O 2.7 ml 10X NEBuffer2 0.5 ml 1M DTT 1.25 ml 100mM dCTP* 0.5 ml T4 DNA polymerase 50 ml total Rxn *NOTE: use dGTP when preparing inserts for pmEGFP-C1-LIC and incubate in thermocycler: 22(C 30min 75(C 20min 4(C 00:00:00. Anneal overhangs of vector and PCR product; combine: 15-30 ng of treated vector* ~30 ng (3ml out of 50ml Rxn from above) and incubate from 20 min to 2 hrs at room temperature . Note: DNA amounts are based on PCR product up to 3kb. Increase insert amount for larger PCR products to satisfy vector to insert molar ratio. *Vector has been digested with appropriate enzyme (1ml enzyme per 1mg of DNA from 2hrs to over-night @ 37(C followed by heat-ina &.@ATUVXmnopt' ( ) . @ A y z  - = Ž}yyuyuyqqhDh`h<GhC h:h:h<Gh:CJaJhrQ hDhDhK\h:h:h:5 h>tp5hvh@(5\hKohrQ5hKoh@(5 h:5 hYm5hv hYmhvhYmhv5hv5CJ aJ h@(hv5CJ aJ ,VWXop( ) A m  = > V h`hgd%Kh`hgdDh`hgd: & F^gdv $^a$gdv$a$gdv= > C U V     0 8 9 ? @ I M N Q Z d v     N P R z   Ӽ渳ϣӆ{hKoh@(OJQJ hKoh@(h@(OJQJhhhrQ5\hnh6; h6;h h5 hv5hg4(hhrQh<Gh>tpCJaJhh@(h'p h%Kh%Kh: h:h:h:h:5h<Gh:CJaJ0  8 9 d   ~ v ` h`hgdrQ h^hgdrQ & F ^gdI}h^hgdg4(h^hgdrQ & F^gdI}gd@(h`hgdh  8 l n r v (2HL\^`bjl  ݿ{wp hhph8hhpH*hnmHsHhrQhpmHsH hKohrQhpOJQJ hKohp hrQhrQhnhphKohI}hKo5\ hvhv hv5hKohp5hKohrQ5hg4(hh jh@(hrQh@(,*HJLPR^`fhnptvz|  BDFHJNPR`blnʼԭwhKomHsHhKoh=H*mHsHh=OJQJhSmHsHhKoh=mHsH hKohKohI}hKo5\ hh5 h*hh h*hKo hKo5 hv5hKoh=5 h6;5h>tph8 jh=h=hKohphh.nHl4b.Jlngd= gdKo pgdh `gdKo ^gdKo & F^gdI} `gdKo `gdKo pgdhnvx246:<>RX^宣wlaYllh,,OJQJh,,h,,OJQJhKoh,,mHsHh>tph,,mHsHh>tphhmHsHh>tph=OJQJh>tphSmHsHh>tph=mHsHhKohKomHsH hwhw5B*mHphsHhKomHsHhiPmHsHhKohpmHsHhKoh=mHsHh=OJQJhSmHsH"^`b.046JLNPhjlnp$(ÿ}yuqðmhwh6;hy%%h>tphI}hKo5\ hB hh hB hKo hKo5 hv5hKohKo5 hB 5hg4(ha4 jh=hKoh=hhhw hwhKo5B*mHphsH hwhw5B*mHphsHh=mHsHhKoh=mHsH(nh.//00L1N1 p@`gdhh^hgd>tph^hgdrP^gdKogd,, p@^`gdfb p@`gdKo @4^4`gdh ^`gdKo & F^gdI}(*,@BDLbdhjN^`n>ξݫݧ~<G jhh>tpmHsHhhmHsHhhOJQJhh@he,hhKoCJaJhwh}hhfbhfb5hfbhg4( hhh,,h>tphKoh,,hhha4 hha4ha4OJQJ0ctivation to improve CIP access to DNA ends) and the overhangs were created similarly to above with T4 DNA polymerase (2units/mg of DNA in presence of 5mM DTT and 2.5mM dGTP) subsequent to dephosphorylation of 5 -termini to prevent self-ligation (0.5 Unit CIP per 1mg DNA, 3hrs @ 37(C). Treated vector was diluted to ~15ng/ml and stored in aliquots at -20(C. Restriction (with heat-inactivation)  CIP  PCR clean  T4 DNA Polymerase  PCR clean Transform appropriate competent cells with 1-3 ml of the annealed plasmid Plate on LB-amp, pick a few colonies for induction with IPTG (bacterial constructs) or PCR screen and sequencing (mammalian and baculoviral constructs) . If the fraction of colonies that over-express your target protein is low: Confirm that PCR reaction gave a strong single band. Re-anneal with LESS insert. Vector sizes pLIC-His 5.3 kb pLIC-GST 5.9 kb pLIC-MBP 5.7 kb pcDNA-LIC (HA and Myc) 5.5 kb pFB-LIC 4.8 kb p15LIC 5.7 kb pFB-GST-LIC 5.5 kb p15strepHt-LIC 5.76 kb pFBstrepHt-LIC 4.9 kb ,,V,Z,,,,,,-<->-----------.....4.6.:.<.............򵪵򔪵z jhhhpmHsHh<GmHsH hh jhhmHsHhhOJQJhhmHsHhcQZh/%h@mHsHhh@mHsHhh@OJQJh@hhhKohh2JUh]/,.../////////////0000060D0H0|000000F1H1L12222{w{w{wshd\hChC5hCh8LhCCJaJh6;h>tphd Ih,,hhh8h8LhrP5CJ\aJhI}hh5\ hhhphhh,,OJQJh# hhh,, hhhhhhhh5 h>ٱ5h,,5,,䴳<Gh)86h<GhS6h<Gh>tp6$N11L2222223L3n33334 p@h^hgd)8 p@h^hgdw p@h^hgdC & F p@gd6; p@h`hgd6;22222222222223"3<3>3B3D3F3J3\3`3|3333334 44h)8hQhdQ1h8LhChwhC56&P1h:p%#/ =!"#$% ^ 2 0@P`p2( 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~_HmH nH sH tH J`J  Normal,BoldCJ_HaJmH sH tH DA D Default Paragraph FontRiR  Table Normal4 l4a (k (No List 4U4 Ym Hyperlink >*phPK![Content_Types].xmlj0Eжr(΢Iw},-j4 wP-t#bΙ{UTU^hd}㨫)*1P' ^W0)T9<l#$yi};~@(Hu* Dנz/0ǰ $ X3aZ,D0j~3߶b~i>3\`?/[G\!-Rk.sԻ..a濭?PK!֧6 _rels/.relsj0 }Q%v/C/}(h"O = C?hv=Ʌ%[xp{۵_Pѣ<1H0ORBdJE4b$q_6LR7`0̞O,En7Lib/SeеPK!kytheme/theme/themeManager.xml M @}w7c(EbˮCAǠҟ7՛K Y, e.|,H,lxɴIsQ}#Ր ֵ+!,^$j=GW)E+& 8PK!Ptheme/theme/theme1.xmlYOo6w toc'vuر-MniP@I}úama[إ4:lЯGRX^6؊>$ !)O^rC$y@/yH*񄴽)޵߻UDb`}"qۋJחX^)I`nEp)liV[]1M<OP6r=zgbIguSebORD۫qu gZo~ٺlAplxpT0+[}`jzAV2Fi@qv֬5\|ʜ̭NleXdsjcs7f W+Ն7`g ȘJj|h(KD- dXiJ؇(x$( :;˹! I_TS 1?E??ZBΪmU/?~xY'y5g&΋/ɋ>GMGeD3Vq%'#q$8K)fw9:ĵ x}rxwr:\TZaG*y8IjbRc|XŻǿI u3KGnD1NIBs RuK>V.EL+M2#'fi ~V vl{u8zH *:(W☕ ~JTe\O*tHGHY}KNP*ݾ˦TѼ9/#A7qZ$*c?qUnwN%Oi4 =3ڗP 1Pm \\9Mؓ2aD];Yt\[x]}Wr|]g- eW )6-rCSj id DЇAΜIqbJ#x꺃 6k#ASh&ʌt(Q%p%m&]caSl=X\P1Mh9MVdDAaVB[݈fJíP|8 քAV^f Hn- "d>znNJ ة>b&2vKyϼD:,AGm\nziÙ.uχYC6OMf3or$5NHT[XF64T,ќM0E)`#5XY`פ;%1U٥m;R>QD DcpU'&LE/pm%]8firS4d 7y\`JnίI R3U~7+׸#m qBiDi*L69mY&iHE=(K&N!V.KeLDĕ{D vEꦚdeNƟe(MN9ߜR6&3(a/DUz<{ˊYȳV)9Z[4^n5!J?Q3eBoCM m<.vpIYfZY_p[=al-Y}Nc͙ŋ4vfavl'SA8|*u{-ߟ0%M07%<ҍPK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-![Content_Types].xmlPK-!֧6 +_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!Ptheme/theme/theme1.xmlPK-! ѐ' theme/theme/_rels/themeManager.xml.relsPK] >=  n^(.24  nN14 8@0(  B S  ?V<S/ 4 8*urn:schemas-microsoft-com:office:smarttagstime #0HourMinute"6:;@pt%')-ADmp 3:<>05718%')67:<NPSUefjly|su   D E F _ ` c R V d h v z  IL%'ADmx3V[579>iwkx%57NPdfz| C R W d l v ~   3333333333333333333333333Xo)A -- 7Pyz %&7Q Q v  yzQ Q  ] ,{}W[:})8n&APDzYbZ ^`o(. ^`hH. pLp^p`LhH. @ @ ^@ `hH. ^`hH. L^`LhH. ^`hH. ^`hH. PLP^P`LhH.HH^H`o(. ^`hH. L^`LhH.   ^ `hH. ^`hH. XLX^X`LhH. ((^(`hH. ^`hH. L^`LhH. hh^h`hH) ^`hH) 88^8`hH) ^`hH() ^`hH() pp^p`hH()   ^ `hH. @ @ ^@ `hH.   ^ `hH.h88^8`o(.h ^`hH.h  L ^ `LhH.h   ^ `hH.h xx^x`hH.h HLH^H`LhH.h ^`hH.h ^`hH.h L^`LhH.88^8`o(. ^`hH. pLp^p`LhH. @ @ ^@ `hH. ^`hH. L^`LhH. ^`hH. ^`hH. PLP^P`LhH.^`o(. ^`hH. pLp^p`LhH. @ @ ^@ `hH. ^`hH. L^`LhH. ^`hH. ^`hH. PLP^P`LhH.] W[8Yb)0l x0)pm x0)n x0&A`{)(ax0)")c()(jd()(j()&.P'w0.(.`{.ax0.P".c)(d()()&()'w0()((()P`{.Pax0.."...c....d ..... ......(& .......P'w0 ........( .........         Ȟ                                   '%@CBYmS}+ /Ipor2J%#y%%/%$?&g4(*,,dQ1T3a4)8<Gd IiPrQcQZK\}hnKo>tpcxCS'p@(yQ6;8e,OO:]/humI}8Lvfb%Kw@`D=wrPWPB #p  @Q Q Q Q X h@h hhhhh,UnknownG* Times New Roman5Symbol3. * ArialA BCambria Math"qh㶆ZĦ3r  24d   2QHX ?@(2!xx3 LIC proceduresvetal99Cynthia Holley$      Oh+'0( @L l x  4 LIC procedure svetal99 Normal.dotmCynthia Holley3Microsoft Office Word@Ik@R\~@`@  ՜.+,0  hp  -CH  4 LIC procedure Title !"#$%&')*+,-./0123456789:;<=>?@ABCEFGHIJKMNOPQRSVRoot Entry FXData  1Table(7WordDocument8>SummaryInformation(DDocumentSummaryInformation8LCompObjy  F'Microsoft Office Word 97-2003 Document MSWordDocWord.Document.89q