ࡱ> BDA bjbj(Q(Q .<J;J;..Tf<!\,} /#\:,0 \. 0!R##00T!#. :   1) Quantify ChIPd DNA with Qubit Protocol works well with 1ng to 500ng of starting material 2) End Repair (NEB Next Kit) 30ul DNA 5ul NEB Next Buffer 2.5ul Enzyme Mix 12.5 H20 50ul Total Incubate 30 minutes at RT or 20 degrees in PCR machine Purify with 1.8 volumes ampure beads ( 90ul) -elute in 43 ul EB 2) A- tailing 42ul DNA 5ul NEB #2 1ul 10mM dATP 2ul Klenow exo- 50ul Total Incubate 30' at 37 degrees ** If using NEB Quick Ligase in Step 3: Purify with 1.8 volumes ampure beads (90ul) elute in 18ul EB ** If using NEB Next Ligation kit in Step 3: Purify with 1.8 volumes ampure beads (90ul) elute in 35ul EB 3) Adaptor Ligation (NEB Quick Ligase OR NEBNext Kit) NEB Quick Ligase: 17ul of DNA 1ul of adaptor mix, scaled based on starting material 1uM if < 10ng 1.5uM if < 50ng 3uM if < 100ng 15uM if < 500ng 20ul of 2x Quick Ligation buffer Mix well on vortex. 2ul of NEB Quick Ligase Incubate @ RT for 30min. Add 10ul EB to sample to bring to 50ul Purify 2X with Ampure beads, each round use 50ul Ampure; elute in 50ul EB, proceed to step 4 NEB Next Ligation Lit: 34ul DNA 1ul adaptor mix, scaled based on starting material 1uM if < 10ng 1.5uM if < 50ng 3uM if < 100ng 15uM if < 500ng 10ul 5x ligase buffer 5ul ligase Incubate 30 minutes at RT or 20 degrees in PCR machine Purify 2X with Ampure beads, each round use 50ul Ampure; elute in 50ul EB 4) Find approximate linear range of amplification with qPCR 10ul 2X SYBR qPCR mix (e.g. SSO Fast from Biorad) 1.4ul 1uM MC703 1.4ul 1uM MC704 1ul Template 6.2ul H20 MC703.TruSeq.p1 caagcagaagacggcatacgaga MC704.TruSeq.p2 aatgatacggcgaccaccgagatc Approximate linear range: If Ct is 14 or below, use 1/5 of material (10ul) and Ct for library amplification If Ct is >14, use one or two cycles below Ct Do not do more than 18 cycles of amplification in a row 5) PCR enrichment with NEBNext Q5 Mix (or Kapa HiFi Hotstart) Library DNA 2X Nebnext High fidelity mix 25ul 25uM PE primer 1ul 25uM PE primer 2 1ul H20 to 50ul Cycling Parameters 98 x 30'' 98 x 10'' 65 x 30'' 72 x 30'' 72 x 5' Hold at 4 degrees Purify samples with 50ul ampure beads and elute with 22ul H20 6) Find library size and calculate concentration of DNA Run 1ul of purified PCR product on a 2% agarose gel, find average length Spec on Qubit to get library concentration as X ng/ul Calculate concentration Z of library: One base pair is 660g/mole (660g/mole)*(avg length) = Y g/mole Z nM = (X/Y)*10^6 7) HTSF needs at least 15ul of 15nM sample per lane If pooling barcoded samples, create pool such that final concentration of pool is 15nM Example: To submit a library composed of four pooled samples, each sample must be present at 3.75nM 3.75nM*(4 samples)=15nM Ampure (SPRI) Beads purification protocol: Before you start, prepare: Fresh 70% ethanol MPC device (standard or plate depending on your choice of Option A or B) 37C heat block (or PCR instrument) Transfer X ul of well mixed SPRI beads from stock bottle into each tube with your reaction sample. Solution is viscous, pipette slowly. Pipette up and down at least 8 times to mix thoroughly. Incubate at RT for 5 minutes (with open lids, to prevent splashing during the opening the lids, if closed). Place your tubes on MPC device for ~ 3 minutes until the liquid appears clear. Remove supernatant via pipetting and discard. Add 300 ul of 70% Ethanol to each tube without disturbing the beads. Do not remove from MPC. Wait for ~ 1 minute and discard the supernatant by using pipette for transfer. Repeat step 6 and 7 for a total of two 70% Ethanol washes. Spin your tubes/strip down for 10 seconds at 1000rpm. Place each tube on MPC for ~30seconds, and then remove the entire remaining Ethanol using 10ul pipette. Place the tube/strip in 37C heat block/PCR block for ~ 2-5 minutes until the pellet appears totally dry. The more PEG is left on your beads, the longer the drying time needed. Add X ul of EB to the dry pellet for eluting the DNA. Pipette mixing the pellet and sit at RT for 2 minutes and put on the MPC. Volume of elution depends on which step of the library preparation it is follow accordingly to protocol directions. Transfer clear supernatant to new tube. **VWR sells an Agencourt replacement that Ive yet to try called MagBind. !"#_beflmqrvw{|}~´´´´©woh #KPJ^Jhwxhvd PJ\^Jhwxhvd \^Jhwxhvd ^Jhwxh #KPJ^Jhvd PJ^Jhwxhvd PJ^J *h #Khvd PJ\^J *h #Khvd \^J *h #Khwx\^Jhwxhwx^Jhwxh #K^Jh #Khvd ^J *h #Khwx^J+"#^_}~< = K L U ` n ~ d^gdwx d`gdwxdgdwx        ! " # ( ) / 0 2 3 5 6 8 9 ; < = @ B C G J K L P Q X Y \ ] c d i j q ĶĨh mhvd 5^Jh mPJ^Jhwxh #KPJ\^Jhvd PJ\^J *h #KhwxPJ\^J *h #Khvd PJ\^J *h #Khvd \^J *h #Khwx\^Jhwxhvd \^J h m^Jhwxhvd ^Jhwxhvd PJ^J2q r x y ~       ; A B F G J K R S Y Z _ ` f i n o q r v w y ƽh mh m^J h m^Jhwxh mPJ^Jhwxh m^Jh mPJ^Jhvd PJ^Jhwxhvd PJ\^Jhwxhvd \^Jhwxhvd ^Jhwxhvd PJ^J?  ; z { |  * : K L m n ^gd mgd m d`gd mdgdwx d^gdwxd^`gd my z { |          " # K L T l ϸϤ~vkvkh!h m^JaJh m^JaJ h m\hwxh mPJ^Jh mPJ^J h m\^J h #K\^J hvd \^J *h mh m>*\^J *h m\^J *h #Khvd PJ\^J *h #Khvd \^J *h #Khwx\^Jhwxhvd \^Jhwxh m^J hvd ^J*         $ % ) : ; < = U Y Z a d k l o ѿѴyhwxhwxPJ^Jhwxhwx^Jhwxhvd PJ^Jhwxhvd ^Jh mh m5\^J h m\^Jh mh mPJ^J *h mh mPJ^J h m^Jh mPJ^Jhwxh mPJ^Jhwxh m^Jh!h m^JaJh m^JaJ/ < = U ^ / z { &'d^`gdwx d`gdwxdgdwx d`gd mgd m         . 5 6 8 9 = > D E J [ _ ` a g h m n p q u v y z { · h4\^J hc4\^J h #K\^J *h #Kh #K\^Jh mhvd PJ^Jh mPJ^Jh #KPJ^J h #K^Jhwxhwx^JhwxhwxPJ^Jhwxhvd PJ^Jhwxhvd ^J; &'wyKLORS]^bcżżżżżż֖ܳ֨~p~p~p *h #Khvd PJ\^J *h #Khvd \^J *h #Kh #K\^Jhwxhvd \^Jh%PJ^Jhwxh%PJ^Jhwxh%^Jhwxhvd ^Jhwxhvd PJ^J hW`^J h%^J h4^Jh4h4^J hc4^J h4\^J hc4\^J)'OxyKL%/8 d`gd #Kdgdwx d^gd%d^`gd% d`gd4cr     '()*123468<=?@ABQRYȽȽȽȽȽȽȽȽȽȽȱȽȽȽȽȽȽȽȽȽȽȽȽȽȽȽh #Khvd 6>*PJ^Jh #Khvd 6>*^Jhwxhvd PJ^Jhwxhvd ^J h #K^Jhwxh #K\^J h&"\^J *h #Kh #K\^J *h #Kh&"\^J@8JK BCiMNXdgd~d^`gd~ d`gd~ d`gd,Rdgdwx d`gd #KYZ^_cdjkpqtuz{  ABM\gi컵毻滯 *hMh~^J *hMhM^J hM^J hvd ^J h~^Jh~h~PJ^Jh~PJ^Jh,RPJ^J *h,Rh,R^J h,R^Jhwxhvd ^Jhwxhvd PJ^J=ྵhwxhB^J hB^Jhwxhwx>*^Jhwxhwx^JhwxhM^J hwx^Jhwxh~^J hM^J *hMh~^JX'rVB* & Fd*$1$gdwxm$ & Fd*$1$^gdwxm$d^`gdwxdgdwxhd^h`gdwxdgdwx d`gdM*`zqdgdwx & Fd*$1$gdwxm$,1h/ =!n"n#n$n% 666666666vvvvvvvvv66666686666666666666666666666666666666666666666666666666hH6666666666666666666666666666666666666666666666666666666666666666666666666662 0@P`p2 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~_HmH nH sH tH V`V Normal*$1$(CJKHPJ^J_H9aJmH nHsH tHDA D Default Paragraph FontViV 0 Table Normal :V 44 la (k ( 0No List J/J Absatz-StandardschriftartP/P WW-Absatz-StandardschriftartNO"N Heading x$OJQJCJPJ^JaJ6B@"6 Body Text x(/@!2( List^JH"@BH Caption xx $CJ6^JaJ].OR. Index $^J<2@b< wx0List 2^`m$j`rj mList Paragraph*$1$^m$KHOJPJQJ^J_HtH PK!pO[Content_Types].xmlj0Eжr(΢]yl#!MB;.n̨̽\A1&ҫ QWKvUbOX#&1`RT9<l#$>r `С-;c=1g'}ʅ$I1Ê9cY<;*v7'aE\h>=,*8;*4?±ԉoAߤ>82*<")QHxK |]Zz)ӁMSm@\&>!7;ɱʋ3װ1OC5VD Xa?p S4[NS28;Y[꫙,T1|n;+/ʕj\\,E:! t4.T̡ e1 }; [z^pl@ok0e g@GGHPXNT,مde|*YdT\Y䀰+(T7$ow2缂#G֛ʥ?q NK-/M,WgxFV/FQⷶO&ecx\QLW@H!+{[|{!KAi `cm2iU|Y+ ި [[vxrNE3pmR =Y04,!&0+WC܃@oOS2'Sٮ05$ɤ]pm3Ft GɄ-!y"ӉV . `עv,O.%вKasSƭvMz`3{9+e@eՔLy7W_XtlPK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-!pO[Content_Types].xmlPK-!֧6 -_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!!Z!theme/theme/theme1.xmlPK-! ѐ'( theme/theme/_rels/themeManager.xml.relsPK]# <q y cY  '8X* !68imrxy|SY>D`f7N_wcjvz{dj  < > ? A J L !' :::1Hhl,̵v^`o(.^`.pL^p`L.@ ^@ `.^`.L^`L.^`.^`.PL^P`L. ^`OJQJo( ^ `OJQJ^Jo(o  ^ `OJQJo( ^`OJQJo(V^V`OJQJ^Jo(o &^&`OJQJo( ^`OJQJo(^`OJQJ^Jo(o ^`OJQJo(hl,1                  vd #KjL m~c4&"W`%sB4,RMwx@p|@Unknown G*Ax Times New Roman5Symbol3 *Cx ArialoWenQuanYi Micro HeiTimes New Roman?Lohit Hindi7@Cambria? *Cx Courier New;WingdingsA$BCambria Math"A h &*' )bbA 20@ P$P&"!xx , Jesse RaabMauro Calabrese   Oh+'0|  , 8 D P\dlt' Jesse Raab Normal.dotmMauro Calabrese12Microsoft Macintosh Word@6F@wR׆@6E@fb ՜.+,0 hp|  '  Title  !"#$%&'()*+,-./02345678:;<=>?@CRoot Entry FfE1Table#WordDocument.<SummaryInformation(1DocumentSummaryInformation89CompObj` F Microsoft Word 97-2004 DocumentNB6WWord.Document.8